get_guide_and_pam
get_guide_and_pam.Rd
Get guide and PAM sequences around the cutsite
Details
This function returns the sequence context of the targeted region. This is, the guide+PAM. Since the coordinates of a break sits to the left of the locus where the enzyme cuts regardless of the strand, the distance to the PAM will be different for the two strands. For example:
If a guide matches the *sense* strand: sgRNA=GACCCCCTCCACCCCGCCTC
<—— guide ——>pam *| <- `*`: break coord; `|`: actual cutsite 5' (+) GACCCCCTCCACCCCGC|CTCNGG <- sense (match) 3' (+) CTGGGGGAGGTGGGGCG|GAGNCC <- antisense (NO match) 0|123456 <- distance from cutsite coord
If a guide matches the *antisense* strand: *| <- `*`: break coord; `|`: actual cutsite 5' (+) CCNGAG|GCGGGGTGGAGGGGGTC <- sense (NO match) 3' (-) GGNCTC|CGCCCCACCTCCCCCAG <- antisense (match) 543210| <- distance from cutsite coord pam<—— guide ——>
which reversed would look like: <—— guide ——>pam |* <- `*`: break coord; `|`: actual cutsite 5' (+) GACCCCCTCCACCCCGC|CTCNGG |012345 <- distance from cutsite coord
and therefore the actual cutsite distance from PAM differs in the sense and antisense strands.