Skip to contents

Get guide and PAM sequences around the cutsite

Usage

get_guide_and_pam(x, cutsiteFromPAM, glen, pamlen, genome)

Arguments

x

GRanges objects with loci to fetch the sequences

cutsiteFromPAM

expected distance of the cutsite from the PAM

glen

length of the guide sequence

pamlen

length of the pam sequence

genome

a bsgenome object (eg. BSgenome.Hsapiens.UCSC.hg38)

Value

A list of DNAStrings with the sense and antisense guide and pam, and the loci.

Details

This function returns the sequence context of the targeted region. This is, the guide+PAM. Since the coordinates of a break sits to the left of the locus where the enzyme cuts regardless of the strand, the distance to the PAM will be different for the two strands. For example:

If a guide matches the *sense* strand: sgRNA=GACCCCCTCCACCCCGCCTC

<—— guide ——>pam *| <- `*`: break coord; `|`: actual cutsite 5' (+) GACCCCCTCCACCCCGC|CTCNGG <- sense (match) 3' (+) CTGGGGGAGGTGGGGCG|GAGNCC <- antisense (NO match) 0|123456 <- distance from cutsite coord

If a guide matches the *antisense* strand: *| <- `*`: break coord; `|`: actual cutsite 5' (+) CCNGAG|GCGGGGTGGAGGGGGTC <- sense (NO match) 3' (-) GGNCTC|CGCCCCACCTCCCCCAG <- antisense (match) 543210| <- distance from cutsite coord pam<—— guide ——>

which reversed would look like: <—— guide ——>pam |* <- `*`: break coord; `|`: actual cutsite 5' (+) GACCCCCTCCACCCCGC|CTCNGG |012345 <- distance from cutsite coord

and therefore the actual cutsite distance from PAM differs in the sense and antisense strands.